Entry information : PabPrx91(PAB00019288 / MA_114903g0010)
Entry ID | 12817 |
---|---|
Creation | 2013-12-19 (Qiang Li) |
Last sequence changes | 2017-06-09 (Justine Latour) |
Sequence status | complete |
Reviewer | Not yet reviewed |
Last annotation changes | 2021-01-18 (Christophe Dunand) |
Peroxidase information: PabPrx91(PAB00019288 / MA_114903g0010)
Name | PabPrx91(PAB00019288 / MA_114903g0010) | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Class | Class III peroxidase [Orthogroup: Prx018] | |||||||||||||||||||||||||
Taxonomy | Eukaryota Viridiplantae Streptophyta Pinaceae Picea | |||||||||||||||||||||||||
Organism | Picea abies (Norway spruce) [TaxId: 3329 ] | |||||||||||||||||||||||||
Cellular localisation | N/D |
|||||||||||||||||||||||||
Tissue type | N/D |
|||||||||||||||||||||||||
Inducer | N/D |
|||||||||||||||||||||||||
Repressor | N/D |
|||||||||||||||||||||||||
Best BLASTp hits |
|
Literature and cross-references PabPrx91(PAB00019288 / MA_114903g0010)
Protein sequence: PabPrx91(PAB00019288 / MA_114903g0010)
Sequence Properties first value : protein second value (mature protein) |
|
||||||||||||
Sequence Send to BLAST Send to Peroxiscan |
|
||||||||||||
Remarks | Complete sequence from genomic. Correct prediction : modified from congenie.org (5' unfounded, frame shift just after"VAKAV", repetition of 2 sequences = suppression : GAACGGATTAAAGGTGGGTTACTACCGTCATACGTGCCCCGAGG ggaggtgattgtaagtgtagttgtggcgaaagccgtgatagcaaatcctggcgttgcaccttctcttatcaggatgcatttccatgactgctttgtcaga) |
||||||||||||
DNA ► Send to BLAST |
|
||||||||||||
CDS► Send to BLAST |
|