Entry information : PabPrx91(PAB00019288 / MA_114903g0010)
| Entry ID | 12817 |
|---|---|
| Creation | 2013-12-19 (Qiang Li) |
| Last sequence changes | 2017-06-09 (Justine Latour) |
| Sequence status | complete |
| Reviewer | Not yet reviewed |
| Last annotation changes | 2021-01-18 (Christophe Dunand) |
Peroxidase information: PabPrx91(PAB00019288 / MA_114903g0010)
| Name | PabPrx91(PAB00019288 / MA_114903g0010) | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Class | Class III peroxidase [Orthogroup: Prx018] | |||||||||||||||||||||||||
| Taxonomy | Eukaryota Viridiplantae Streptophyta Pinaceae Picea | |||||||||||||||||||||||||
| Organism | Picea abies (Norway spruce) [TaxId: 3329 ] | |||||||||||||||||||||||||
| Cellular localisation | N/D |
|||||||||||||||||||||||||
| Tissue type | N/D |
|||||||||||||||||||||||||
| Inducer | N/D |
|||||||||||||||||||||||||
| Repressor | N/D |
|||||||||||||||||||||||||
| Best BLASTp hits |
|
Literature and cross-references PabPrx91(PAB00019288 / MA_114903g0010)
Protein sequence: PabPrx91(PAB00019288 / MA_114903g0010)
| Sequence Properties first value : protein second value (mature protein) |
|
||||||||||||
| Sequence Send to BLAST Send to Peroxiscan |
|
||||||||||||
| Remarks | Complete sequence from genomic. Correct prediction : modified from congenie.org (5' unfounded, frame shift just after"VAKAV", repetition of 2 sequences = suppression : GAACGGATTAAAGGTGGGTTACTACCGTCATACGTGCCCCGAGG ggaggtgattgtaagtgtagttgtggcgaaagccgtgatagcaaatcctggcgttgcaccttctcttatcaggatgcatttccatgactgctttgtcaga) |
||||||||||||
| DNA ► Send to BLAST |
|
||||||||||||
| CDS► Send to BLAST |
|
||||||||||||
