1. Browse the Database
  2. View Redoxidase
Entry information : MtuCP01_CNFD04045
Entry ID 3599
Creation 2006-08-23 (Filippo Passardi)
Last sequence changes 2006-08-23 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2006-08-23 (Christophe Dunand)
Peroxidase information: MtuCP01_CNFD04045
Name MtuCP01_CNFD04045
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Bacteria Actinobacteria Actinobacteria (class) Mycobacteriaceae Mycobacterium
Organism Mycobacterium tuberculosis    [TaxId: 1773 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtuCP01_CNFD04045
start..stop		 S start..stop
MboCP01_AF2122/97 1499 0 1..761 1..740
MtuCP01_CNFD04001 1498 0 1..761 1..740
MtuCP01_CNFD04007 1497 0 1..761 1..740
MtuCP01_H37rv 1496 0 1..761 1..740
Literature and cross-references MtuCP01_CNFD04045
Literature Zhang,M., Yue,J., Yang,Y.P., Zhang,H.M., Lei,J.Q., Jin,R.L.,
Zhang,X.L. and Wang,H.H.

Detection of Mutations Associated with Isoniazid Resistance in
Mycobacterium tuberculosis Isolates from China

J. Clin. Microbiol. 43 (11), 5477-5482 (2005)
DNA sequence http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=DQ056360&doptcmdl=GenBank
Protein ref. UniProtKB:   Q4TUW2
DNA ref. GenBank:   66737295
Protein sequence: MtuCP01_CNFD04045
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   761 (303)
PWM (Da):   %s   82788.37 (32807.5)  
PI (pH):   %s   4.77 (9.17) Peptide Signal:   %s   cut: 28 range:28-330
Sequence
Send to BLAST
Send to Peroxiscan
*.........1 .........2 .........3 .........4 .........5 .........6 .........7 .........8 .........9 .........0 .........1 .........2
MPEQHPPITE TTTGAASNGC PVVGHMKYPV EGGGNQDWWP NRLNLKVLHQ NPAVADPMGA AFDYAAEVAT IDVDALTRDI EEVMTTSQPW WPADYGHYGP LFIRMAWHAA GTYRIHDGRG  GAGGGMQRFA PLNSWPDNAS LDKARRLLWP VKKKYGKKLS WADLIVFAGN CALESMGFKT FGFGFGRVDQ WEPDEVYWGK EATWLGDERY SGKRDLENPL AAVQMGLIYV NPEGPNGNPD  PMAAAVDIRE TFRRMAMNDV ETAALIVGGH TFGKTHGAGP ADLVGPEPEA APLEQMGLGW KSSYGTGTGK DAITSGIEVV WTNTPTKWDN SFLEILYGYE WELTKSPAGA WQYTAKDGAG  AGTIPDPFGG PGRSPTMLAT DLSLRVDPIY ERITRRWLEH PEELADEFAK AWYKLIHRDM GPVARYLGPL VPKQTLLWQD PVPAVSHDLV GEAEIASLKS QILASGLTVS QLVSTAWAAA  SSFRGSDKRG GANGGRIRLQ PQVGWEVNDP DGDLRKVIRM QPQVGWEVND PDGDLRKVIR TLEEIQESFN SAAPGNIKVS FADLVVLGGC AAIEKAAKAA GHNITVPFTP GRTDASQEQT  DVESFAVLEP KADGFRNYLG KGNPLPAEYM LLDKANLLTL SAPEMTVLVG GLRVLGANYK RLPLGVFTEA SESLTNDFFV NLLDMGITWE PSPADDGTYQ GKDGSGKVKW TGSRVDLVFG 
SNSELRALVE VYGADDAQPK FVQDFVAAWD KVMNLDRFDV R 

Retrieve as FASTA  
Remarks Complete sequence from genomic. Probable sequencing error: extra cytidine (gcacccctg --> gcaccctg) was removed just after "LRKVIRT" (not "LRKVIRM"!), otherwise a frameshift occurs and the rest of the sequence has not homology with a CP. The authors of the sequencing mention (p.5481) that there is no frameshift in this CP, although (!) the NCBI accession includes this frameshift and shows a truncated form.
Note the unusual insertion of a quite large fragment: "LRKVIRMQPQVGWEVNDPDGD". (DNA: TGCAGCCACAAGTCGGGTGGGAGGTCAACGACCCC
GACGGGGATCTGCGCAAGGTCATTCGCAC). Interestingly, an insertion (4bp) was also seen at the same site in MtuCP01_C18.